Showing 1 - 20 results out of 848 with the query:
*
with facets:
Vendor:UC Davis/NIH NeuroMab Facility X
Kv9.1 K+ channel antibody
KCNS1 Mouse
UC Davis/NIH NeuroMab Facility
75-450
(UC Davis/NIH NeuroMab Facility Cat# 75-450, RRID:AB_2637014)
monoclonal antibody
N461/19
mouse
originating manufacturer of this product
31cd1b1c-47e4-5038-a22d-931731472f32
HCN2 ion channel antibody
HCN2 ion channel NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-111
(UC Davis/NIH NeuroMab Facility Cat# 75-111, RRID:AB_2279449)
monoclonal antibody
N71/37
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Western Blot; Immunoprecipitation; ICC, IB, IHC, IP
ac9bad9d-b6ab-5e81-a519-c329cecd471d
Kv7.2/KCNQ2 potassium channel antibody
Kv7.2/KCNQ2 potassium channel NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-079
(UC Davis/NIH NeuroMab Facility Cat# 75-079, RRID:AB_2131704)
monoclonal antibody
N26A/23
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IHC; Immunohistochemistry; Western Blot; Immunoprecipitation
911a7ac6-90b2-5dc8-b60c-9c5efbe31d36
Pan-Nav1 antibody
Pan-Nav1 NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-407
(UC Davis/NIH NeuroMab Facility Cat# 75-407, RRID:AB_2493099)
monoclonal antibody
N419/78
mouse
Originating Manufacturer
f0093e1c-49da-5b62-9ca8-8a8e14cdd020
EAAC1 transporter antibody
EAAC1 transporter human
UC Davis/NIH NeuroMab Facility Go To Vendor
75-219
(UC Davis/NIH NeuroMab Facility Cat# 75-219, RRID:AB_2286203)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunoprecipitation; ICC, IP
40027674-129d-5e0c-93b9-82fbc22780d1
Wave1/SCAR antibody
Wave1/SCAR NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-048
(UC Davis/NIH NeuroMab Facility Cat# 73-048, RRID:AB_10671317)
monoclonal antibody
K91/36
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, KO, IP; Immunohistochemistry; Western Blot; Immunoprecipitation
963b50e1-c129-5477-aa3c-6962f4ff620e
Ataxin-1, 11NQ antibody
Ataxin-1 11NQ NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-117
(UC Davis/NIH NeuroMab Facility Cat# 73-117, RRID:AB_10671173)
monoclonal antibody
N76/8
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b ICC, IB, IHC, KO, IP; Immunohistochemistry; Immunoprecipitation; Western Blot
68e6f758-761c-54b2-a10a-7f3c29b4b1ab
Shank2 scaffold protein antibody
Shank2 scaffold protein NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-088
(UC Davis/NIH NeuroMab Facility Cat# 75-088, RRID:AB_2254586)
monoclonal antibody
N23B/6
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, IP; Immunohistochemistry; Immunoprecipitation; Western Blot
fa468211-2fad-51c0-a6b9-72b87599bddf
SAP102 MAGUK scaffold protein antibody
SAP102 MAGUK scaffold protein NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-058
(UC Davis/NIH NeuroMab Facility Cat# 73-058, RRID:AB_10671660)
monoclonal antibody
N19/2; Variable light sequences:AAAATTGTGCTAACTTAGTCTCCGCCCCCCTGTCTGTGACTCCAGGAAATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAATATTAACAACAACCTACACTGGTATAAACAAAAATCACATGAGTCTCCAAGGCTTCTCATCAAGTATGCTTCCCAGTCCATCTCTGGGATCCCCTCCAGGTTCAGGGGCAGGGGATCAGGGACAGATTTCACTCTCAGTATCAACAGGGTGGAAACTGAAAATTTTGGAATGTATTTCTGTCAACAGAGTAACATTTGGCCGTACATGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTGCAGCTGGTGGAATCTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTACCTATGGCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAGCCATTAGTAGTGGTGGTTATTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACGATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAAGTCTGAGGACACAGCCATGTATTACTGTGCAAGAAGGGATTACGACGACGGTTATACTATGGATTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, KO, IP; Western Blot; Immunohistochemistry; Immunoprecipitation
fd8181fc-e293-547c-95a8-8d494f93cd22
Pan-SAPAP antibody
Pan-SAPAP NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-156
(UC Davis/NIH NeuroMab Facility Cat# 75-156, RRID:AB_10671947)
monoclonal antibody
N127/31; Variable light sequences:AGCAACAACTGTGACCCAGTCTCAAAAATTCATGTCCACATCAGTAGGAGACAGGGTCAGCGTCACCTGCAAGGCCAGTCAGAATGTGGGTACTTATGTAGCCTGGTATCAACAGAAACCAGGGCAATCTCCTAAAGCACTGATTTACTCGGCATCCTACCGATACAGTGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCTTCAGCAATGTGCAGTCTGAAGACTTGGCAGAGTATTTCTGTCAGCAATATAACAACTATCCTCTGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAC; Heavy DNA sequences:GCCTCAAGCAGTCAGGTGCAGCTGAAGGAGTCTGGAGGAGGCTTGGTGCAACCTGGAGGATCCATGAAACTCTCCTGTGTAGCCTCTGGATTTTCTTTCAGTAGCTACTGGATGTCTTGGGTCCGCCAGTCTCCAGAGAAGGGGCTTGAGTGGGTTGCTGAAATTAGATTGAAATCTGATAATTATGCAACACATTATGCGGAGTCTGTGAAAGGGAAGTTCACCATCTCAAGAGATGATTCCAAAAGTCGTCTCTACCTGCAAATGAACAGCTTACTAGCTGAAGACACTGGAATTTATTACTGTACCGCCGGGGGACCCTGGTTTGGTTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Immunohistochemistry; Western Blot; Immunocytochemistry; ICC, IB, IHC
364368e1-a112-56f2-96cd-1cbc2c6b15a0
GABA(A)R, Beta1 antibody
GABA(A)R Beta1 NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-137
(UC Davis/NIH NeuroMab Facility Cat# 75-137, RRID:AB_2109406)
monoclonal antibody
N96/55; Variable light sequences:AGAATCGTGATGACCCAGTCTCCATCTTCCATGTATGCATCTCTAGGAGAGAGAGTCACCATCACTTGTAAGGCGAGTCAGGACATTGAAAGCTATTTAAGCTGGTTCCAGCAGAAACCAGGGAAATCTCCTAAGACCCTGATCTATCGTGCAAATAGATTGGCAGATGGGGGCCCATCAAGGTTCAGTGGCAGTGGATCTGGGCAAGATTTTTCTCTCACCATCAGCAGCCTGGACTATGAAGATATGGGAATTTATTATTGTCTACAGTACGATGAGTTTCCTCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTGAAGCTGAAGCAGTCTGGGTCTGAGCTGGTGAGGCCCAGAGCTTCAGTGAAGCTGTCCTGCAAGGCTTCTGACTACACATTCACCAACTACTGGATGCACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAATGGATTGGAAATGTTTTTCCTTCTAGTGGTAGGACTAATTACGATGCGATTTTCAAGAGCAAGGCCACACTGACTGTAGACACATCCTCCAGAACAGTCTACTTGCAGCTCACTAGCCTTACATCTGAGGACTCTGCGGTCTATTTCTGTACTAGCGGCCTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunoprecipitation; Western Blot; Immunohistochemistry; ICC, IB, IHC
66f9cf02-31c7-577a-ad8b-e15ebb315e25
Neuregulin-CRD (Cysteine-rich domain, Type III) antibody
Neuregulin-CRD (Cysteine-rich domain Type III) NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-226
(UC Davis/NIH NeuroMab Facility Cat# 73-226, RRID:AB_10672412)
monoclonal antibody
N126B/31
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b ICC; Immunocytochemistry; Western Blot
98d5dbc2-0051-5ae8-8164-129477a25534
TrpC7 Trp channel antibody
TrpC7 Trp channel NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-123
(UC Davis/NIH NeuroMab Facility Cat# 73-123, RRID:AB_10672526)
monoclonal antibody
N64A/36
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunoprecipitation; Western Blot; Immunohistochemistry; IB, IHC, IP
d119a768-39e5-52be-8dd4-678843882f02
Kv4.3 potassium channel antibody
Kv4.3 potassium channel NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-017
(UC Davis/NIH NeuroMab Facility Cat# 73-017, RRID:AB_10672856)
monoclonal antibody
K75/41
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Western Blot; Immunoprecipitation; ICC, IB, IHC, KO
ea27ce29-0453-549f-9cff-2e0be33b64cc
Mitofusin-2 antibody
Mitofusin-2 NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-173
(UC Davis/NIH NeuroMab Facility Cat# 73-173, RRID:AB_10672973)
monoclonal antibody
N153/5; Variable light sequences:AGAATTGTGATGACCCAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATGCAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAATTATATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCTATCTTGCATCCAACCTAGAGTCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGTTGTAACCTATTACTGTCAGCACAGTAGGGAGTTTCCGCTCACGTTCGGTGCTGGGACCAGGCTGGAGCTGAAAC; Heavy DNA sequences:GCCTCAAGCAGTCAGGTTCAGCTGCAGCAGTCTGGGACTGTGCTGGCAAGGCCTGGGGCTTCCGTGAAGATGTCCTGCAAGGCTTCTGGCTACAGCTTTACCAGCTACTGGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTAGAGTGGATTGGTGCTATTTATCCTGGAAATAGTGATACTAGGAACAACCAGAAGTTCAAGGGCAAGGCCAAACTGACTACAGTCACATCCGCCAGCACTGCCTACATGGAGCTCAGCAGCCTGACAAATGAGGACTCTGCGGTCTATTACTGTACAAGAGAGGTACGACGTGGCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a Western Blot; Immunohistochemistry; ICC, IB, IHC
e749f321-1d1e-5c0d-b97f-a9d10d6dcdd8
Shank1 scaffold protein antibody
Shank1 scaffold protein NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-064
(UC Davis/NIH NeuroMab Facility Cat# 73-064, RRID:AB_10673108)
monoclonal antibody
N22/21; Variable light sequences:AAAAACAACTGTGACCCAGTCTCCATCCTCCCTGGCTGTGTCAGCAGGAGAGAAGGTCACTATGAGCTGCAAATCCTGTCAGAGTCTGCTCAACAATAGACCCCGAAAGAACTTCTTGGCTTGGTACCAACAGAAACCAGGGCAGTCTCCTAAACTGCTGATCTACTGGGCATCCACTAGGGAATCTGGGGTCCCTGATCGCTTCACAGGCAGGGGATCTGGGACAGATTTCACTCTCACCATCAGAAGTGGGCAGGCTGAAGACCTGGCAGTTTATTACTGAAAGCAATCTTATAATCTTCCGGACGTTCGGGGGAGGCACCAAGCTGGAAATCAAACG; Heavy DNA sequences:GCCTCAAGCAGTGAGGTGAAGCTGATGGAATCTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGGTATGGCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCTACCGTTAATAGTGGTGGTAGTTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGTACGCCCTGTACCTGCAAATGCGCAGTCTGAAGTCTGAGGACACAGCCATATATTACTGTACAAGACAAGGTTACTTCCCGTTTACTTACTGGGGCCAAGGGACTCGGTCACTGTTTTTGC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC; Immunohistochemistry; Western Blot
82b775e1-8ad5-5a3e-8d50-16d7b9101ad5
Ankyrin-G (staining) scaffold protein antibody
Ankyrin-G (staining) scaffold protein NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-147
(UC Davis/NIH NeuroMab Facility Cat# 73-147, RRID:AB_10673449)
monoclonal antibody
N106/65
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Immunohistochemistry; Immunocytochemistry; ICC, IHC
d83d7eb8-bd9e-59a2-a739-126cee6921fa
Copper ATPase 2 antibody
Copper ATPase 2 NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-143
(UC Davis/NIH NeuroMab Facility Cat# 75-143, RRID:AB_2290260)
monoclonal antibody
L62/29
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB; Immunohistochemistry; Immunoprecipitation; Western Blot
fba8b89b-ca86-5c24-b689-cf5842b8d38d
Mad3 antibody
Mad3 NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
73-227
(UC Davis/NIH NeuroMab Facility Cat# 73-227, RRID:AB_10674581)
monoclonal antibody
N129A/6
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Immunocytochemistry; Western Blot; ICC
0c974fab-00e7-5564-bd54-71049846bc3f
Kvbeta1.2 potassium channel antibody
Kvbeta1.2 potassium channel NULL
UC Davis/NIH NeuroMab Facility Go To Vendor
75-019
(UC Davis/NIH NeuroMab Facility Cat# 75-019, RRID:AB_10674579)
monoclonal antibody
K47/42
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, KO, IP; Immunohistochemistry; Immunoprecipitation; Western Blot
b81aaf6d-37ad-5de5-bb2b-b290ec592ce6