Showing 1 - 20 results out of 867 with the query:
*
with facets:
Vendor:UC Davis/NIH NeuroMab Facility X
Pan-Ankyrin antibody
Pan-Ankyrin null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-381
(UC Davis/NIH NeuroMab Facility Cat# 73-381, RRID:AB_2336913)
monoclonal antibody
N388A/60
mouse
Originating Manufacturer
53c914e0-5641-54bb-8261-39152faedd39
Navbeta3 antibody
Navbeta3 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-391
(UC Davis/NIH NeuroMab Facility Cat# 73-391, RRID:AB_2336910)
monoclonal antibody
N396/29
mouse
Originating Manufacturer
c247563b-4cdb-541d-93d3-d43799009c0b
Kir6.1 antibody
Kir6.1 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-394
(UC Davis/NIH NeuroMab Facility Cat# 73-394, RRID:AB_2336907)
monoclonal antibody
N366/60
mouse
Originating Manufacturer
817b32e8-3155-54b3-8370-871f6e867b7a
GABA-A-R-Alpha6 antibody
GABA-A-R-Alpha6 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-388
(UC Davis/NIH NeuroMab Facility Cat# 73-388, RRID:AB_2336906)
monoclonal antibody
N229A/32
mouse
Originating Manufacturer
bbb840d1-9b55-58c0-81c2-0695a223faec
CLN6 antibody
CLN6 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-385
(UC Davis/NIH NeuroMab Facility Cat# 73-385, RRID:AB_2336903)
monoclonal antibody
N400/24
mouse
Originating Manufacturer
489b33e6-f4ef-5cc5-bc25-b4c51e770df3
GFP antibody
GFP null
UC Davis/NIH NeuroMab Facility Go To Vendor
75-131
(UC Davis/NIH NeuroMab Facility Cat# 75-131, RRID:AB_10671445)
monoclonal antibody
N86/8
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a Western Blot; Immunohistochemistry; Immunoprecipitation; ICC, IP
f6e2fc6f-e98f-55de-a865-332b7c5bd09c
LRP4 (cytoplasmic) antibody
LRP4 (cytoplasmic) null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-182
(UC Davis/NIH NeuroMab Facility Cat# 73-182, RRID:AB_10672256)
monoclonal antibody
N164/6; Variable light sequences:AGAATTGTGATGACTCAGACTCCGCTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAAATCTAGTCAGATCCTTGTACACAGTAATGGAAACACCTATTTACATTGGTACCTGCAGAAGCCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCAACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGCGTGGAGGCTGAGGATCTGGGAGTTTATTTCTGCTCTCAAACTACACATGTTCCGTGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTTCAGCTGCAGCAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTGTCCATCACTTGCACTGTCTCTGAGTTTTCATTAACCACCTATGGTGTTCACTGGGTTCGCCAGCCTCCAGGAAAGGGTCTGGAGTGGCTGGGAGTGATATGGGCTGGTGGAAACACAAATTATAATTCGGCTCTCATGTCCAGACTGAGAATCAGCAAAGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCTGGAAACTGATGACACAGCCATGTACTACTGTGCCAGAGGCTACAATGATTACGACTGGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Western Blot; Immunocytochemistry; Immunoprecipitation; ICC, IB
e6c4f3cf-0023-5408-8198-671b983bf0dc
LRP4 (extracellular, ectodomain) antibody
LRP4 (extracellular ectodomain) null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-221
(UC Davis/NIH NeuroMab Facility Cat# 73-221, RRID:AB_10672257)
monoclonal antibody
N207/27
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a ICC, IB; Western Blot; Immunocytochemistry
57dbfb3b-d620-5895-8ade-b1bccaf3e4a7
GABABR2 antibody
GABABR2 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-125
(UC Davis/NIH NeuroMab Facility Cat# 73-125, RRID:AB_10672297)
monoclonal antibody
N81/37; Variable light sequences:AAAATTGTGATGACTCAGGCTGCACCCTCTGTACCTGTCACTCCTGGAGAGTCAGTATCCATCTCCTGCAGGTCCAGTAGGAGTCTCCTGCATAGTGATGGGAACACTTACTTGTATTGGTTCCTACAGAGGCCAGGCCAGTCTCCTCAGCTCCTGATATATCGGATGTCCAACCTTGCCTCAGGAGTCCCTGACAGGTTCAGTGGCAGTGGGTCAGGAACTGCTTTTACACTGAGAATCAGTAGAGTGGAGGCTGAGGATGTGGGTATTTATTACTGTCTGCAACATCTAGAATATCCATTCACGTTCGGCTCGGGGACAAAGTTGGAAATAAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTGAAGCTGATGGAATCTGGGGGAGGCTTAGTGAAGCCTGGAGGGTCCTTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAGTTATGCCTTGTCTTGGGTTCGCCAGACTCCGGAGAAGAGGCTGGAGTGGGTCGCAACCATTAGTAATGGCGGTGGTTACACCTACTATTCAGACAGTGTGAAGGGTCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTCTGAGGTCTGAGGATACGGCCATGTATTACTGTTCAAGAGAGGGTAGTAGGTCGGGCTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, KO; Immunohistochemistry; Western Blot; Immunoprecipitation
4a4061c2-4caa-504e-867d-c75b76de05f8
Nav1.6 sodium channel antibody
Nav1.6 sodium channel null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-026
(UC Davis/NIH NeuroMab Facility Cat# 73-026, RRID:AB_10673284)
monoclonal antibody
K87A/10
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Immunoprecipitation; ICC, IHC, KO, IP
72a45d95-f9b0-5fcd-b0fe-28db00ae074b
Mortalin/GRP75 antibody
Mortalin/GRP75 null
UC Davis/NIH NeuroMab Facility Go To Vendor
75-127
(UC Davis/NIH NeuroMab Facility Cat# 75-127, RRID:AB_2120479)
monoclonal antibody
N52A/42; Variable light sequences:AGACATTGTGCTGACTCAGTCTCCATCCTCCTTATCTGCCTCTCTGGGAGAAAGAGTCAGTCTCACTTGTCGGGCAAGTCAGGAAATTAGTGGTTACTTAAGCTGGATTCAGCAGAAACCAGATGGAGCTATTAAACGCCTGATCTACGCCGCATCCACTTTAGATTCTGGTGTCCCGAAAAGGTTCAGTGGCAGTAGGTCTGGGTCAGATTATTCTCTCACCATCAGCAGCCTTGAGTCTGAAGATTTTGCAGACTATTACTGTCTACAATATGCTATTTATCCTCGGACGTTCGGTGGAGGCACCAAGCTGGAAATCAAAC; Heavy DNA sequences:GCCTCAGCAGTCAGGTGCAGCTGAAGGAGTCAGGACCTAGCCTCGTGAAACCTTCTCAGACTCTGTCCCTCACCTGTTCTGTCACTGGCGACTCCATCACCAGTGGTTACTGGAACTGGATCCGGAAATTCCCAAGGAATAAATTTGAGCACATGGGGTACATAAACTACAGTGGTAACACTTACTACAATCCATCTCTCAAAAGTCGAATCTCCATCACTCGAGACACATCCAAGAACCAGTACTACCTGCAGTTGAATTCTGTGACTACTGAGGACACAGCCACATATTACTGTGCAAGGGGGGGTTACGACGGGGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, IP; Immunohistochemistry; Western Blot; Immunoprecipitation
85fb2d07-0747-5290-babb-fb90a82180b3
GABA(A)R, Alpha1 antibody
GABA(A)R Alpha1 null
UC Davis/NIH NeuroMab Facility Go To Vendor
75-136
(UC Davis/NIH NeuroMab Facility Cat# 75-136, RRID:AB_2108811)
monoclonal antibody
N95/35
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a Western Blot; Immunohistochemistry; Immunoprecipitation; ICC, IB, IHC, KO
d337e61a-06b1-517f-abf0-614f561e6df3
Neuroligin-1 antibody
Neuroligin-1 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-160
(UC Davis/NIH NeuroMab Facility Cat# 73-160, RRID:AB_10671307)
monoclonal antibody
N97A/31
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB, IHC, KO; Immunohistochemistry; Immunocytochemistry; Western Blot
7ed8b759-595d-5f73-9c75-75a717b40b1d
Neuroligin-4* antibody
Neuroligin-4* null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-138
(UC Davis/NIH NeuroMab Facility Cat# 73-138, RRID:AB_10671308)
monoclonal antibody
N98/7; Variable light sequences:AGAAATTGTGATGTCCAGTCTCCAGCCCCCTGTCTGTGACTCCAGGAAATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAATATTAGCAACAACCTACACTGGTATCAACAAAAATCACATGAGTCTCCAAGGCTTCTCATCAAGTTTGCTTCCCAGCCCATCTCTGGGATCCCCTCCAGGTTCAGGGGCAGGGGATCAGGGACAGATTTCACTCTCAGTATCAACAGTGTGGAGACTGAAGATTTTGGAATGTATTTCTGTCAACAGAGTAACAGCTGGCCTCTCACGTTCGGGGCTGGGACCAAGCTGGACCTGAGAC; Heavy DNA sequences:GCCTCAAGCAGTCAGATCCAGTTGGTGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAAAATCAAAGACACCTACATGCACTGGGTGAAGCAGAGGCCTGACCAGGGCCTGGAGTGGATTGGAAGGATTGAGCCTGTGAATAGTGATACTAAATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACTGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGCTAGTAACTGGGACCCTTACTGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Western Blot; Immunoprecipitation; ICC, IB
78116171-3e81-57ca-9b93-bb46c2c9c338
Olig1 antibody
Olig1 null
UC Davis/NIH NeuroMab Facility Go To Vendor
75-180
(UC Davis/NIH NeuroMab Facility Cat# 75-180, RRID:AB_2157532)
monoclonal antibody
N149/25; Variable light sequences:AGAATCCAGAGACTCAGTCTCCATCCTCCCTGAGTGTGTCAGCAGGAGAGAAGGTCACTATGAGTTGCAAGTCCAGTCAGAGTCTGTTAAGCAGTGGAAATCAAAAGAACTACTTGGCCTGGTACCAGCAGAAACCAGGGCAGCCTCCTAAAGTGTTGATCTACGGGGCATCCAGTAGGGGATCTGGGGTCCCTGATCGCTTCACAGGCAGTGGATCTGGAACCGATTTCACTCTTACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTATTACTGTCAGAATGATCATAGTTATCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTCCAGCTCCAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATATCCTGCAAGGCTTCTGGCTACACTTTCATAGACTACTATATAAACTGGGTGAAACAGAAGCCTGGGCAGGGACTTGAGTGGATTGGATGGATTTATCGTGGAAGCGGTTATATTAACTACAATGATAAATTCAAGGGCAAGGCCACATTGACTGTGGACACATCCTCCAGCACAGCCCACATGCAGCTCAGTAGCCTGACATCTGAAGACACTGCTGTCTATTTCTGTGCAAGTGGGAACTATGATTACGACTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Western Blot; Immunocytochemistry; ICC, IHC
60f61e09-3df4-57e2-aa49-7ed55a5eea32
MPP8 antibody
MPP8 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-154
(UC Davis/NIH NeuroMab Facility Cat# 73-154, RRID:AB_10673400)
monoclonal antibody
N119/44
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Western Blot; Immunocytochemistry; ICC
90778ed0-49fe-5a81-bff8-68cf1de81b6e
Pan-GRK antibody
Pan-GRK null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-179
(UC Davis/NIH NeuroMab Facility Cat# 73-179, RRID:AB_10671656)
monoclonal antibody
N145/20; Variable light sequences:ATAATTGTGCTAACTTAGTCTCCAGCCCCCTGTCTGTGACTCCAGGAAAATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAATATTAACAACAACCTACACTGGTATCAACAAAAATCACATGAGTCTCCAAGGCTTCTCATCAAGTATGCTTCCCAGTCCATCTCTGGGATCCCCTCCAGGTTCAGGGGCAGGGGATCAGGGACAGATTTCACTCTCAGTATCAACAGTGTGGAAACTGAAAATTTTGGAATGTTTTTCTGTCAACAGAGTAACATCTGGCCGTACATGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAAC; Heavy DNA sequences:GCCTCAAGCAGTGAGGTGCAGCTGGTGGAATTTGGGGGAGACTTAGTGAAGCCTGGAGGGTCCCTGAAACTTTCCTGTGCAGCCTCTGGATTCACTTTCAGTACCTATGGCATGTTTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAGCCATTAGTAGTGGTGGTTATTACACCTACTATCCAGACAGTGTGAAGGGGCGATTCACCATTTCCAGAGACGATGCCAAGAACACCCTGTACCTGCAAATGAGCAGTTTGAAGTTTGAGGACACAGCCATGTATTACTGTGCAAGAAGGGATTACGACGACGGTTATACTATGGATTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB; Western Blot; Immunocytochemistry
51b5d409-617d-5bd2-9a98-4dde70f06417
RGS14 antibody
RGS14 null
UC Davis/NIH NeuroMab Facility Go To Vendor
75-170
(UC Davis/NIH NeuroMab Facility Cat# 75-170, RRID:AB_2179931)
monoclonal antibody
N133/21; Variable light sequences:AGAATCAAGATGACCCAGTCTCACAAATTCATGTCCACATCAGTAGGAGACAGGGTCACCATCACCTGCAAGGCCAGTCAGGATGTGGGTACTGCTGTAGGCTGGTTTCAGCAGAAGCCAGGGCAATCTCCTAAACTACTCATTTACTGGGCATCCACCCGGCACACTGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATTAGGAATGTGCAGTCTGATGACTTGGCAGATTATTTCTGTCAGCAATATAGCAGCTATCCTCTCACGTTCGGCTCGGGGACAAAGTTGGAAATAAAAC; Heavy DNA sequences:GCCTCAAGCAGTCAGGTGCAGCTGAAGCAGTCTGGACCTGAGCTGGTGAAGCCTGGGGCTTCAGTGAAGATACCCTGCAAGGCTTCTGGATACACATTCACTGACGACAACATGGACTGGGTGAAGCAGAGCCATGGAAAGAGCCTTGAGTGGATTGGAGATATTAATCCTAACAATGGTGGTACTATCTACAACCAGAAATTCAAGGGCAAGGCCACATTGACTGTAGACAAGTCCTCCAGTACAGCCTACATGGAGCTCCGCAGCCTGACATCTGAGGACACTGCAGTCTATTACTGTGCAAGAGGGAAACTCCCGTTTGCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGC
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a Immunocytochemistry; Immunohistochemistry; Western Blot; ICC, IB, IHC, KO
f5ade9d9-8f8b-5d08-93bd-1bfb1a5f31ca
SCG10/Stathmin-2 antibody
SCG10/Stathmin-2 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-063
(UC Davis/NIH NeuroMab Facility Cat# 73-063, RRID:AB_10671663)
monoclonal antibody
L5/1
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Immunohistochemistry; Immunoprecipitation; ICC, IHC, IP
bf9ed8b4-583d-5efd-a25f-3b7c103297c2
SNAT1 transporter antibody
SNAT1 transporter null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-155
(UC Davis/NIH NeuroMab Facility Cat# 73-155, RRID:AB_10671664)
monoclonal antibody
N104/37
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB; Western Blot; Immunocytochemistry
2b32e27d-e4e0-589b-a2ad-f080380c635c