Showing 1 - 20 results out of 872 with the query:
*
with facets:
Vendor:UC Davis/NIH NeuroMab Facility X
Pan-Nav1 Na+ channel antibody
UC Davis/NIH NeuroMab Facility Go To Vendor
73-407
(UC Davis/NIH NeuroMab Facility Cat# 73-407, RRID:AB_2491081)
monoclonal antibody
N419/78
mouse
Originating Manufacturer
ec8956a5-c39c-5576-9636-e58bf2187858
Anti-Pan-Kvbeta potassium channel antibody
Pan-Kvbeta K+ channel null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-392
(UC Davis/NIH NeuroMab Facility Cat# 73-392, RRID:AB_2336899)
monoclonal antibody
K25/73
mouse
Originating Manufacturer; useful for Immunoblot, Immunocytochemistry and Immunohistochemistry
61be4667-9a7c-504d-9e9a-e6bda878351b
ATAT1 antibody
ATAT1 human
UC Davis/NIH NeuroMab Facility Go To Vendor
75-426
(UC Davis/NIH NeuroMab Facility Cat# 75-426, RRID:AB_2637013)
monoclonal antibody
N347/42
mouse
originating manufacturer of this product
c17325ac-99de-50b0-a527-39096f2f6701
BDNF antibody
BDNF mouse
UC Davis/NIH NeuroMab Facility Go To Vendor
73-470
(UC Davis/NIH NeuroMab Facility Cat# 73-470, RRID:AB_2637015)
monoclonal antibody
N450/53
mouse
originating manufacturer of this product
b7683a64-76c1-5f40-9b46-2af2c0667be5
Navbeta1 Na+ channel antibody
SCN1B rat
UC Davis/NIH NeuroMab Facility Go To Vendor
75-425
(UC Davis/NIH NeuroMab Facility Cat# 75-425, RRID:AB_2637012)
monoclonal antibody
N405/74
mouse
originating manufacturer of this product
4b6f92ca-e1f0-5341-89bb-930d8ccea309
Kv8.2 antibody
KCNV2 mouse
UC Davis/NIH NeuroMab Facility Go To Vendor
73-435
(UC Davis/NIH NeuroMab Facility Cat# 73-435, RRID:AB_2532091)
monoclonal antibody
N448/88
mouse
Originating Manufacturer
c2ae820b-449d-552b-a590-5054a38aafff
Mouse Anti-Rat Kir2.2 potassium channel Monoclonal Antibody, Unconjugated, Clone N24/1
Mouse Rat Kir2.2 potassium channel Clone N24/1 human, mouse, rat
UC Davis/NIH NeuroMab Facility Go To Vendor
75-068
(UC Davis/NIH NeuroMab Facility Cat# 75-068, RRID:AB_10198756)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Western Blot; IB, IHC
2d4bca07-937a-5754-ae11-265e475ae2d2
Mouse Anti-Human Dardarin kinase Monoclonal Antibody, Unconjugated, Clone N5/9
Mouse Human Dardarin kinase Clone N5/9 mouse, rat, rat, mouse
UC Davis/NIH NeuroMab Facility Go To Vendor
73-062
(UC Davis/NIH NeuroMab Facility Cat# 73-062, RRID:AB_10198993)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgM; IgM Immunohistochemistry; Western Blot; IB, IHC
535c1adf-3bb9-5810-bfcd-ab36f2d3812b
Mouse Anti-Rat Kir2.2 potassium channel Monoclonal Antibody, Unconjugated, Clone N24/1
Mouse Rat Kir2.2 potassium channel Clone N24/1 human, mouse, rat
UC Davis/NIH NeuroMab Facility Go To Vendor
73-068
(UC Davis/NIH NeuroMab Facility Cat# 73-068, RRID:AB_10198994)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Western Blot; Immunohistochemistry; IB, IHC
d5a1ddd2-00b8-574d-82ef-1e2c133aeec4
Mouse Anti-Human Dardarin kinase Monoclonal Antibody, Unconjugated, Clone N5A/44
Mouse Human Dardarin kinase Clone N5A/44 rat, mouse, rat
UC Davis/NIH NeuroMab Facility Go To Vendor
73-077
(UC Davis/NIH NeuroMab Facility Cat# 73-077, RRID:AB_10199278)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a IB, IHC; Western Blot; Immunohistochemistry
741c701b-e765-57cc-b924-fd8b6581c94e
Neuroligin-4* antibody
Neuroligin-4* null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-138
(UC Davis/NIH NeuroMab Facility Cat# 73-138, RRID:AB_10671308)
monoclonal antibody
N98/7; Variable light sequences:AGAAATTGTGATGTCCAGTCTCCAGCCCCCTGTCTGTGACTCCAGGAAATAGCGTCAGTCTTTCCTGCAGGGCCAGCCAAAATATTAGCAACAACCTACACTGGTATCAACAAAAATCACATGAGTCTCCAAGGCTTCTCATCAAGTTTGCTTCCCAGCCCATCTCTGGGATCCCCTCCAGGTTCAGGGGCAGGGGATCAGGGACAGATTTCACTCTCAGTATCAACAGTGTGGAGACTGAAGATTTTGGAATGTATTTCTGTCAACAGAGTAACAGCTGGCCTCTCACGTTCGGGGCTGGGACCAAGCTGGACCTGAGAC; Heavy DNA sequences:GCCTCAAGCAGTCAGATCCAGTTGGTGCAGTCTGGGGCAGAGCTTGTGAAGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAAAATCAAAGACACCTACATGCACTGGGTGAAGCAGAGGCCTGACCAGGGCCTGGAGTGGATTGGAAGGATTGAGCCTGTGAATAGTGATACTAAATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACACATCCTCCAACACTGCCTACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGCTAGTAACTGGGACCCTTACTGGCACCACTCTCACAGTCTCCTC
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 Immunohistochemistry; Western Blot; Immunoprecipitation; ICC, IB
78116171-3e81-57ca-9b93-bb46c2c9c338
SNAT1 transporter antibody
SNAT1 transporter null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-155
(UC Davis/NIH NeuroMab Facility Cat# 73-155, RRID:AB_10671664)
monoclonal antibody
N104/37
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, IB; Western Blot; Immunocytochemistry
2b32e27d-e4e0-589b-a2ad-f080380c635c
Histone H3-pThr11 antibody
Histone H3-pThr11 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-224
(UC Davis/NIH NeuroMab Facility Cat# 73-224, RRID:AB_10673391)
monoclonal antibody
N123/48
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC, ELISA; Immunocytochemistry; Western Blot
02ed3f9f-f03f-5cae-91e4-29d2c766e1fd
MPP8 antibody
MPP8 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-154
(UC Davis/NIH NeuroMab Facility Cat# 73-154, RRID:AB_10673400)
monoclonal antibody
N119/44
mouse
Originating Manufacturer; manufacturer recommendations: IgG2b Western Blot; Immunocytochemistry; ICC
90778ed0-49fe-5a81-bff8-68cf1de81b6e
VMAT2 antibody
SLC18A2 mouse
UC Davis/NIH NeuroMab Facility Go To Vendor
73-436
(UC Davis/NIH NeuroMab Facility Cat# 73-436, RRID:AB_2532092)
monoclonal antibody
N449/73
mouse
Originating Manufacturer
5b295350-b77b-50fc-a992-553bfea9c775
Ankyrin-G (staining) antibody
Fusion protein human, mouse, rat
UC Davis/NIH NeuroMab Facility Go To Vendor
73-342
(UC Davis/NIH NeuroMab Facility Cat# 73-342, RRID:AB_2315803)
monoclonal antibody
N106/43
mouse
Originating Manufacturer; Antigen Specie:Human; Applications:ICC, IHC
a20b2f19-7f3d-508d-a389-7b82375f413d
TWIK-2 potassium channel antibody
KCNK6 mouse
UC Davis/NIH NeuroMab Facility Go To Vendor
75-463
(UC Davis/NIH NeuroMab Facility Cat# 75-463, RRID:AB_2686915)
monoclonal antibody
N469/28
mouse
Originating manufacturer of this product, Manufacturer approved use: Immunoblot and Immunocytochemistry
068f7948-b863-5e42-bf93-ce1bb1fb73b2
Lhx6.1 antibody
Lhx6.1 null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-241
(UC Davis/NIH NeuroMab Facility Cat# 73-241, RRID:AB_10697881)
monoclonal antibody
N228A/16
mouse
Originating Manufacturer; manufacturer recommendations: IgG1 ICC; Immunocytochemistry; Western Blot
7403e6d1-7236-5050-8640-e19639105d14
Clcn5 antibody
Clcn5 ion channel null
UC Davis/NIH NeuroMab Facility Go To Vendor
73-400
(UC Davis/NIH NeuroMab Facility Cat# 73-400, RRID:AB_2341103)
monoclonal antibody
N406/47
mouse
Originating Manufacturer
6971816d-b7ce-58d9-9998-13f797ddc074
Mouse Anti-Human Dardarin kinase Monoclonal Antibody, Unconjugated, Clone N5A/18
Mouse Human Dardarin kinase Clone N5A/18 rat, mouse, rat
UC Davis/NIH NeuroMab Facility Go To Vendor
73-076
(UC Davis/NIH NeuroMab Facility Cat# 73-076, RRID:AB_10222919)
monoclonal antibody
mouse
Originating Manufacturer; manufacturer recommendations: IgG2a IB, IHC; Immunohistochemistry; Western Blot
fc3d9ef3-5293-5087-ac1c-d0dfc5c14c09